The MADS-box gene family encodes transcription factors that determine organ identity and regulate organ development in terrestrial plants^[1-4]. MADS-box genes are classified as type Ⅰ (SRF type) or type Ⅱ (MEF-2 type), depending on whether they possess intervening (I), keratin-like (K), and C-terminal (C) domains. Type Ⅱ MADS-box genes, comprising MIKC* and MIKC^c genes, are further divided into several subfamilies, including AGAMOUS-LIKE (AG), AGAMOUS-LIKE6 (AGL6), DEFICIENS (DEF)/GLOBOSA (GLO), and TM8. Among them, the TM8 subfamily was considered one of the most ancient among the MADS-box subfamilies in seed plants^{[3, 5]}.

Gene counts in the TM8 subfamily have changed considerably since the divergence of angiosperms and gymnosperms, with a notable expansion of TM8-like genes in most gymnosperm lineages^{[3, 6]}. In contrast, TM8 genes have disappeared completely in five independent angiosperm lineages^[6], including those in model plants of the Brassicaceae and Poaceae families^{[7, 8]}. The gain and loss of TM8 genes is strongly correlated with the diversity of reproductive organ morphologies in seed plants, as evidenced by their placement on the seed plant phylogenetic tree^{[3, 5]}.

Although the TM8 gene was first identified more than three decades ago^[9], our understanding of the functions of TM8-like genes remains limited, with only a few studies investigating their role in flower development in the cucumber(Cucumis sativus L.)^[10] and tomato(Solanum lycopersicum L.)^[11]. Moreover, while research efforts have documented the diversity and phylogenetic relationships of TM8 genes in seed plants, deciphering their ancestral functions from the varied expression patterns continues to pose a significant challenge^[3]. Furthermore, despite evidence of the involvement of three TM8-like genes in Ginkgo biloba L. and one gene in Taxus baccata Thunb. in female ovule development and fruit ripening^[12], the precise functions of TM8-like genes in gymnosperms have not yet been fully characterized.

Gnetum (Gnetophyta) is a genus of pantropical trees, shrubs, and lianas^{[13, 14]}. Eighteen TM8-like genes have been identified in G. luofuense C. Y. Cheng, including several present in both vegetative and reproductive organs (e.g., TnS0006125g01), several present exclusively in reproductive organs (e.g., TnS001008199g01 and TnS013912549g01), and two showing differential expression across seed development stages (TnS000061251g01 and TnS000980857g01)^[15], suggesting significant roles in seed ripening^[16]. Thus, TM8-like genes may play diverse roles in the regulation of reproductive organ development in Gnetum, although this requires further empirical support.

Alternative splicing (AS) introduces complexity to the transcriptome and enhances the functional diversity of plant genes^{[17, 18]}. Intron retention is the most prevalent type of AS in both angiosperms, such as Oryza sativa L.^[19], and gymnosperms, such as G. biloba^[20], and similarly dominates AS events detected using full-length transcriptomic sequencing of Gnetum leaves, female strobili, and seeds^{[16, 21, 22]}. Consequently, it can be hypothesized that different splice forms of TM8-like genes play different roles in reproductive organ development in Gnetum, although this requires further verification.

This study aimed to elucidate the diverse roles of TM8-like genes and their isoforms arising from AS events in Gnetum. Fluorescence in situ hybridization (FISH) was conducted on the reproductive organs of G. montanum Markgr., and transgenic experiments were performed on Arabidopsis thaliana (L.) Heynh., a broadly distributed genus in Southeast Asia^{[13, 14]}. Overall, the results of this study enrich our understanding of MADS-box genes and shed light on the evolution of reproductive organ development in seed plants.

1.   Materials and Methods

1.1   Plant materials

Reproductive tissues of G. montanum were collected from one female and one male specimen at the Xishuangbanna Botanical Garden in Yunnan, China, on 3 May 2019, during the anthesis of both female and male strobili. Permission was obtained to collect the plant materials from the Xishuangbanna Botanical Garden. Each involucral collar was dissected from a female and male strobilus and cleaned with distilled water.

1.2   TM8-like gene cloning

Three TM8-like genes (TnS001008199g01, TnS013912549g01, and TnS000980857g03), representing three independent G. luofuense lineages^[15], were selected for study in a related lianoid species, G. montanum. Given the close phylogenetic relationship between G. montanum and G. luofuense^{[13, 14]}, it is presumed that these TM8-like genes are involved in female and male reproductive organ development in Gnetum. The full-length coding sequences of the three TM8-like genes were cloned into the pGBKT77 and pGADT7 vectors.

1.3   Material preparation and sectioning

All materials were immediately incubated for 12 h in formalin-acetic acid-alcohol (FAA) fixative solution prepared with diethylpyrocarbonate (DEPC) water. After fixation, the plant materials were dehydrated in gradient alcohol, embedded in paraffin, sectioned using a microtome (Jinhua Yidi Medical Appliance Co., Ltd., Zhejiang, China), and extended at 62 ℃ for 2 h. For each section, paraffin was removed through a series of chemical treatments: twice with xylene for 15 min each, twice with anhydrous ethanol for 5 min each, followed by 85% alcohol for 5 min, 75% alcohol for 5 min, and finally DEPC solution. All sections were incubated in sodium citrate antigen retrieval solution for 15 min, then cooled at room temperature. Subsequently, 20 μg/mL proteinase K was added to digest the repairing solution for 22 min at 37 ℃. After washing with pure water, each section was incubated in phosphate-buffered saline (PBS) for 5 min at room temperature. The procedure was repeated three times. After rinsing with 3% methyl alcohol, each section was placed in the dark for 15 min and incubated in PBS (pH 7.4) for 5 min at room temperature. This procedure was also repeated three times.

1.4   Probe design and FISH hybridization

Probes for FISH were designed using Primer software version 5.21^[23]. The probe sequences targeting the three genes and two transcripts of TnS000980857g03 were: TnS001008199g01 (AGCGGCTGCCTGTACTCCTTCATGGTAAAATA), TnS013912549g01 (CCTAGCGTTTCAACATTTGACTTCAGCGTCT), TnS000980857g03 (TCCCCCATAATATTCACTGGATCGGAGAATT), and TnS000980857g03 (AATCTTTTCTGTATCAACATCCATCCCA). Prior to FISH, digoxigenin was attached to both ends of these probes.

Each prepared section was incubated in prehybridization solution containing probes at 37 ℃ for 1 h. The prehybridization solution was then removed, and the sections were incubated with 1 μmol/L hybridization solution containing probes overnight at room temperature. Subsequently, each section was washed with 2 × prehybridization solution (SSC) at 37 ℃ for 10 min, followed with 1 × SSC for 5 min and 0.5 × SSC for 10 min at room temperature. Anti-DIG-HRP enzyme solution was then dropped onto each section, followed by incubation at 37 ℃ for 50 min. Each section was further washed with PBS for 5 min. The procedure was repeated three times. A solution of 10 μg/mL 2-(4-amidinophenyl)-6-indolecarbamidine dihydrochloride (DAPI) was dropped onto each section, followed by incubation in the dark for 8 min at room temperature. After washing off the DAPI solution, anti-fluorescence quenching sealing agent was dropped onto each section. FISH images were captured using a Nikon ECLIPSE CI microscope (Nikon Corporation, Tokyo, Japan). Blue light images were obtained using ultraviolet excitation (330-380 nm) and an emission wavelength of 420 nm. Red light images were obtained using Cy3 red light excitation (510-560 nm) and an emission wavelength of 590 nm. Blue and red light images were merged to generate combined images.

1.5   Transgenic experiments

The three TM8 genes and two TnS000980857g03 transcripts were cloned and ligated to the pCambia1301-35SN vector using restriction enzyme digestion. The prepared vector was then transformed into Agrobacterium tumefaciens GV3101 and further transformed into A. thaliana (Columbia) flowers using the floral dip method. After 15-20 d, transgenic A. thaliana seeds were harvested in batches and screened in kanamycin-resistant medium to obtain transgenic-positive plants.

A. thaliana seeds from the T₀ generation, showing robust growth and plumpness, were selected and disinfected with 1 mL of sodium hypochlorite disinfectant for 7 min. After removing the disinfectant, all seeds were placed evenly on culture medium. After vernalization at 4 ℃ for 3 d, the culture dish was moved to a culture room under lights. Approximately 8 d later, germinated seeds were transferred to a culture pot under the following conditions: 22 ℃ temperature, 65%-80% humidity, and long day length (16 h light and 8 h dark). To prevent accidental hybridization between different strains, bagging was implemented during the late stage of seed collection. For each gene/alternative splice form, seeds from two transgenic A. thaliana lines were harvested and recultivated from the T₁ to T₃ generation; at least 15 individuals from each line were planted. Wild-type (strain Col-0) was also grown from the T₁ to T₃ generation.

1.6   Phenotyping and RT-PCR validation

Flowers of the T₃ generation were collected for further analysis. A Nikon ECLIPSE CI microscope was used to observe floral morphology of transgenic A. thaliana. The expression of the three TM8 genes and two TnS000980857g03 transcripts was measured using RT-PCR analysis, with three sample replicates and three technical replicates. Primer information is provided in Table 1. The RT-PCR conditions were as follows: 10 min of initial denaturation at 95 ℃, followed by 40 cycles of 15 s at 95 ℃ and 60 s at 60 ℃, from 60 ℃ to 95 ℃ (increased by 0.3 ℃ every 15 s), and a final extension at 72 ℃ for 5 min. The Actin gene was used as an internal reference, and relative gene expression was calculated using the ΔΔCT method^[24].

Table  1.  Primers used in the present study

Gene	Direction	Primer sequence (5'-3')	Product length / bp
Actin	F	GCCGACAGAATGAGCAAAGAG	134
	R	TGCTGGAAGGTACTGAGGGAG
TnS001008199g01	F	GAAGGATAACGCAAGGCTGAA	255
	R	TCCTCCTGATTTGCTGCTGTT
TnS013912549g01	F	GCAGCTCAGCAGGATCGAAAG	291
	R	TGTAGCCTTTCAATCCGACCA
TnS000980857g03 (Transcript 1)	F	TGTTGCCCTGCTTATTTACTCC	206
	R	TGCGTACCTCGTCTGCCAAT
TnS000980857g03 (Transcript 2)	F	TCTACCAATTCTCCGATCCAGTG	160
	R	TCTGCCAATACATGGATCTCCTC

下载: 导出CSV 

| 显示表格

2.   Results and Analysis

2.1   Cloning of three TM8-like genes

Results revealed two amino acid differences between TnS001008199g01 from G. montanum and the putative protein from G. luofuense (Fig. 1: A), but no amino acid differences between TnS013912549g01 from G. montanum and the putative protein from G. luofuense (Fig. 1: B). In contrast, a pronounced gap of 46 amino acids was found between the two TnS000980857g03 transcripts, along with several amino acid differences between TnS000980857g03 and putative protein from G. luofuense (Fig. 1: C).

Figure  1.  Sequence comparison of TM8-like proteins in Gnetum montanum

A: Amino acid sequence of TnS001008199g01; B: Amino acid sequence of TnS013912549g01; C: Amino acid sequences of two TnS000980857g03 transcripts. Red squares and black arrows indicate differences in amino acids.

下载: 全尺寸图片 幻灯片

2.2   FISH of female and male strobili

The nucellus of the G. montanum female ovule was enclosed by three coverings: the outer covering or seed envelope, middle covering, and inner covering or integument (Fig. 2: A, as defined by Berridge^[25]). The FISH results indicated that TnS001008199g01 was strongly expressed in all three coverings and the nucellus (Fig. 2: B). TnS013912549g01 was strongly expressed in the nucellus, inner covering, and outer covering but relatively weakly expressed in the middle covering (Fig. 2: C). One TnS000980857g03 transcript was strongly expressed in the outer covering but weakly expressed in the middle and inner coverings and the nucellus (Fig. 2: D), while the other TnS000980857g03 transcript was strongly expressed in the nucellus and all three coverings (Fig. 2: E).

Figure  2.  Schematic showing of female and male strobili in Gnetum montanum and results of FISH hybridization

A: Female ovules in a whorl, and anatomical structure of female ovule; B-E: FISH analysis of a female ovule under blue, red, and combined light, white bars represent 500 μm. B: Expression of TnS001008199g01; C: Expression of TnS013912549g01; D: Expression of TnS000980857g03 transcript 1; E: Expression of TnS000980857g03 transcript 2. F: Schematic showing whorls of involucral collars in G. montanum male ovule, sterile ovules and antherophores in a whorl, and anatomical structure of sterile ovule (left) and male reproductive unit (right). G-J: FISH analysis of a sterile ovule under blue, red, and combined light, white bars represent 100 μm. G: Expression of TnS001008199g01; H: Expression of TnS013912549g01; I: Expression of TnS000980857g03 transcript 1; J: Expression of TnS000980857g03 transcript 2. K-N: FISH analysis of antherophores under blue, red, and combined light, white bars represent 100 μm. K: Expression of TnS001008199g01; L: Expression of TnS013912549g01; M: Expression of TnS000980857g03 transcript 1; N: Expression of TnS000980857g03 transcript 2.

下载: 全尺寸图片 幻灯片

Sterile ovules consisted of a sterile nucellus and two coverings, i.e., outer and inner coverings (Fig. 2: F). FISH analysis revealed that TnS001008199g01 was highly expressed in the outer and inner coverings but weakly expressed in the abortive nucellus (Fig. 2: G). TnS013912549g01 was strongly expressed in the upper portion of the nucellus and outer covering but relatively weakly expressed in the inner covering (Fig. 2: H). TnS000980857g03 transcript 1 was strongly expressed in the outer and inner coverings but weakly expressed in the nucellus (Fig. 2: I). In contrast, TnS000980857g03 transcript 2 was strongly expressed in the outer and inner coverings (Fig. 2: J).

The entire microsporangiophore, enclosed by a sheath-like bract (Fig. 2: F), consisted of a pair of microsporangia filled with many pollen grains, with each microsporangium connected to a stalk. TnS001008199g01 was highly expressed in the sheath-like bract, microsporangia, stalks, and pollen grains (Fig. 2: K). TnS013912549g01 was strongly expressed in the bract and pollen grains but weakly expressed in the microsporangia and stalks (Fig. 2: L). TnS000980857g03 transcripts 1 and 2 were both strongly expressed in the bract, microsporangia, stalks, and pollen grains (Fig. 2: M, N).

2.3   Floral characters and RT-PCR analysis of transgenic Arabidopsis thaliana

Wild-type A. thaliana flowers were composed of four sepals, four petals, four long stamens, two short stamens, and one pistil (Fig. 3: A, B). In contrast, the transgenic A. thaliana flowers exhibited marked alterations in gross morphology. Transformation with TnS001008199g01 resulted in petal and short stamen fusion in both line 1 (Fig. 3: C) and line 2 (Fig. 3: D). Transformation with TnS013912549g01 resulted in substantially enlarged stamens in both line 1 (Fig. 3: E) and line 2 (Fig. 3: F). Transformation with TnS000980857g03 transcript 1 led to the absence of short stamens in both line 1 (Fig. 3: G) and line 2 (Fig. 3: H), while transformation with TnS000980857g03 transcript 2 led to a significant reduction of short stamens in many flowers (Fig. 3: I) or their general absence (Fig. 3: J) in line 1. In line 2, short stamens were generally absent (Fig. 3: K), and several flowers possessed five long stamens (Fig. 3: L).

Figure  3.  Transgenic experiments of TM8 genes and their transcripts in Arabidopsis thaliana

A, B: Flower of wild-type Arabidopsis thaliana in bloom (a) and unfolded (b); C, D: Floral morphology of TnS001008199g01 transgenic plants from line 1 (c) and line 2 (d), arrows indicate fusion of a petal and stamen; E, F: Floral morphology of TnS013912549g01 transgenic plants from line 1 (e) and line 2 (f), arrows indicate emergence of enlarged stamens; G, H: Floral morphology of TnS000980857g03 transgenic plants from line 1 (g) and line 2 (h), arrows indicate missing short stamens; I, J: Floral morphology of transgenic plants with AS form of TnS000980857g03 from line 1, arrows indicate missing or reduced short stamen; K, L: Floral morphology of transgenic plants with two transcripts of TnS000980857g03 from line 2, arrows indicate missing short stamen or emergence of a fifth long stamen. White bars represent 1 mm.

下载: 全尺寸图片 幻灯片

The RT-PCR results revealed that no expression was detected in the flowers of wild-type A. thalaina (Fig. 4). In contrast, TnS001008199g01 was strongly expressed in both line 1 and line 2. TnS013912549g01 and TnS000980857g03 transcript 1 were relatively strongly expressed in line 1 and line 2. TnS000980857g03 transcript 2 was strongly expressed in line 1 but relatively weekly expressed in line 2.

Figure  4.  RT-PCR analysis of three TM8-like genes and one AS form

1: Wild type; 2: TnS001008199g01 line 1; 3: TnS001008199g01 line 2; 4: TnS013912549g01 line 1; 5: TnS013912549g01 line 2; 6: TnS000980857g03 line 1; 7: TnS000980857g03 line 2; 8: TnS000980857g03 AS type line 1; 9: TnS000980857g03 AS type line 2.

下载: 全尺寸图片 幻灯片

3.   Discussion

TM8 genes have been implicated in the development of female reproductive organs in seed plants. For example, the expression of ERAF17, a TM8-like gene, is associated with the development of female flowers in cucumbers in response to ethylene^[10], while another TM8 gene is reported to influence early floral development and hypocotyl growth in tomatoes^[26]. GbMADS6 and GbMADS11, two TM8-like genes, exhibit strong expression in the female ovules of G. biloba, while another TM8-like gene displays strong expression in the ovule and young developing arils of T. baccata^[12]. GpMADS1, a recently identified TM8-like gene^[15], shows an increase in expression during the early stage of female ovule development in G. parvifolium, coinciding with the differentiation of the nucellus and three coverings^[27]. In the present study, FISH analysis revealed that all three TM8 genes were strongly expressed in the outer ovule covering, suggesting that TM8-like genes are extensively involved in female ovule development in G. montanum. Furthermore, TnS013912549g01 and TnS000980857g03 were both weakly expressed in the middle covering of the female ovules, whereas TnS001008199g01 exhibited strong expression. These results indicate that different TM8-like genes may play different roles during the mature stages of female ovule development in G. montanum.

Gnetum possesses "bisexual" yet functionally unisexual reproductive organs^[28]. Previous studies have reported that several Type Ⅱ MADS-box genes control the initiation and subsequent development of sterile ovules in Gnetum. For example, the AG-like gene GGM3 is ubiquitously expressed in the early stages of sterile ovule development in G. gnemon, but its expression is restricted to the outer ovule covering during later developmental stages^[29]. Furthermore, GGM3 and GGM7 are predominantly expressed in the two coverings and abortive nucellus of sterile ovules in G. gnemon, while the AGL6-like gene GGM11 is exclusively expressed in the abortive nucellus^[29]. Our results showed that the three TM8-like genes were all strongly expressed in the outer covering of the sterile ovule, highlighting their significance in the development of sterile ovules in Gnetum. Nevertheless, the three TM8 genes displayed distinct expression patterns and likely fulfill different roles. TnS001008199g01 and the two transcripts of TnS000980857g03 were strongly expressed in both coverings, whereas TnS013912549g01 showed strong expression in the upper portion of the abortive nucellus and weaker expression in the middle covering of sterile ovules.

In addition to their roles in female and sterile ovules, TM8-like genes may also contribute to the development of male reproductive units in Gnetum. Previous studies have observed poorly viable pollen and irregularly shaped stamens in tomato plants overexpressing TM8^[11]. In G. gnemon, the AG-like gene GGM3 is strongly expressed in the entire sheath-like bract and microsporangia, whereas the DEF/GLO-like gene GGM15 is restricted to the sporogenous tissue^[30]. Consistent with these results, all TM8-like genes were strongly expressed in the sheath-like bracts and pollen grains, supporting their involvement in antherophore development in G. montanum. In addition, TnS001008199g01 and TnS000980857g03 expression in the microsporangia and stalks was higher than that of TnS013912549g01. Moreover, short stamens were absent or highly reduced in transgenic A. thaliana expressing TnS000980857g03. Short stamens and petals were fused in A. thaliana expressing TnS001008199g01, whereas stamens were enlarged in A. thaliana expressing TnS013912549g01. These results demonstrate that TM8-like genes are essential for male reproductive unit development in G. montanum and they fulfill distinct functions.

In this study, we also focused on functionally characterizing the transcripts of TM8-like genes. TnS000980857g03 transcript 1 was weakly expressed in the nucellus and middle and inner coverings of the female ovule, whereas TnS000980857g03 transcript 2 was strongly expressed in these tissues. Moreover, although the loss of one stamen was a typical phenomenon in the transgenic A. thaliana flowers, transformation with the TnS000980857g03 AS form resulted in one reduced short stamen and five long stamens. These results confirm that AS indeed enhances the functions of TM8 genes during reproductive organ development in G. montanum.

4.   Conclusions

Previous studies have suggested that TM8 genes are ancient MADS-box genes^{[3, 5, 6]}. Their importance in reproductive organ development may have declined over the course of angiosperm evolution, as evidenced by the loss of TM8-like genes in at least five distantly related lineages^[6]. In contrast, TM8-like genes have undergone a dramatic expansion in gymnosperms, especially in Pinaceae and Gnetum^[3]. The increase in TM8-like genes in gymnosperms indicates that they may have gained new roles in reproductive organ development. This hypothesis was corroborated by our results showing that TM8-like genes and their different AS forms play diverse roles in both female and male strobilus development in Gnetum. Further investigation is needed to explore the roles of other TM8-like genes and their transcripts in Gnetum reproductive organ development. The insights gained from this study will facilitate our understanding of the evolution of reproductive organs in seed plants.